pAAV/EF1a-DIO-SCLM
(Plasmid #216759)

• Purpose: AAV2 transfer vector for Cre recombinase-dependent expression of SuperClomeleon from the human elongation factor 1a promoter
• Depositing Lab: George Augustine
• Publication: AAV2 transfer vectors for a genetically encoded chloride indicator, SuperClomeleon (unpublished)

Backbone

• Vector backbone: pAAV-Ef1a-DIO SwiChRca-TS-EYFP
• Backbone manufacturer: Karl Deisseroth (Addgene plasmid # 55631)
• Backbone size w/o insert (bp): 5343
• Total vector size (bp): 6729
• Modifications to backbone: The human growth hormone polyA terminator was replaced by the shorter bovine one.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SuperClomeleon
• Alt name: Cerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
• Species: A. victoria (crystal jelly)
• Insert Size (bp): 1386
• Mutation: S30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
• Promoter: EF1a (human elongation factor 1 alpha)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: NcoI (not destroyed)
• 5′ sequencing primer: tcaagcctcagacagtggttc
• 3′ sequencing primer: agccatacgggaagcaatagc

Resource Information

• Supplemental Documents:
  • pAAV_EF1a-DIO-SCLM.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry