pAAV/CMV-SCLM
(Plasmid
#216758)
-
PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 61591)
- Backbone size w/o insert (bp) 3481
- Total vector size (bp) 6147
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperClomeleon followed by WPRE and human growth hormone polyA terminator
-
Alt nameCerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
-
SpeciesA. victoria (crystal jelly)
-
Insert Size (bp)2666
-
MutationS30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
- Promoter CMV (cytomegalovirus)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer ggctgttgggcactgacaat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV/CMV-SCLM was a gift from George Augustine (Addgene plasmid # 216758 ; http://n2t.net/addgene:216758 ; RRID:Addgene_216758)