Skip to main content
Addgene

pFP122
(Plasmid #21669)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21669 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Ted
  • Backbone manufacturer
    W. Kramer
  • Vector type
    centromeric plasmid
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lacz
  • Alt name
    2 copies of lacZ
  • Alt name
    pJH1439
  • Alt name
    see author's map
  • Species
    E. coli
  • Insert Size (bp)
    3000
  • Mutation
    The second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 36-bp sequence (AG TTTCAGCTTTCCGCAATAGTATAATTTTATAAAC) which differs from an HO cut site by only one substitution but cannot be cut
  • Entrez Gene
    lacZ (a.k.a. ECIAI39_0334)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bam Hi (not destroyed)
  • 3′ cloning site Eco RI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ
gene in inverted orientation, with one copy containing an HO endonuclease
cleavage site.

Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFP122 was a gift from James Haber (Addgene plasmid # 21669 ; http://n2t.net/addgene:21669 ; RRID:Addgene_21669)
  • For your References section:

    Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Pâques F, Haber JE. Mol Cell Biol. 1997 Nov . 17(11):6765-71. PubMed 9343441