Skip to main content
Addgene

pAAV-hSynapsin1-FLEx-axon-jGCaMP8m-WPRE-SV40
(Plasmid #216533)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216533 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5116
  • Total vector size (bp) 6461
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    axon-jGCaMP8m
  • Insert Size (bp)
    1345
  • Promoter hSynapsin1
  • Tag / Fusion Protein
    • GAP43 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG (CAG-F)
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSynapsin1-FLEx-axon-jGCaMP8m-WPRE-SV40 was a gift from Yuki Kambe (Addgene plasmid # 216533 ; http://n2t.net/addgene:216533 ; RRID:Addgene_216533)

  • For your References section:

    Enhanced Aversive Signals During Classical Conditioning in Dopamine Axons in Medial Prefrontal Cortex. Abe K, Kambe Y, Majima K, Hu Z, Ohtake M, Momennezhad A, Izumi H, Tanaka T, Matunis A, Stacy E, Itokazu T, Sato TR, Sato TK. bioRxiv. 2023 Aug 24:2023.08.23.554475. doi: 10.1101/2023.08.23.554475. Preprint. 10.1101/2023.08.23.554475 PubMed 37662305
Related items: