pCfB2197-PrGNP1-mK2-NatMX
(Plasmid #216513)

• Purpose: Integrative fluorescent reporter for amino acid uptake sensing pathway, comprising mKate2 driven by the GNP1 promoter within the Easy clone vector, requires NotI digestion for integration in yeast
• Depositing Lab: Juha Saarikangas
• Publication: Paukstyte et al Mol Biol Cell. 2025 Apr 2:mbcE24040162. doi: 10.1091/mbc.E24-04-0162.

Backbone

• Vector backbone: pCfB2197
• Backbone manufacturer: Irina Borodina Easy Clone 2.0 (Addgene #67551)
• Backbone size w/o insert (bp): 5916
• Total vector size (bp): 7622
• Modifications to backbone: Cut with SfaAI (AsiSI) and nicked with Nb.BsmI
• Vector type: Yeast Expression, Cre/Lox ; Integrative
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PrGnp1-mKate2
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1714
• Promoter: GNP1

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: GAAATTCGCTTATTTAGAAGTGTC
• 3′ sequencing primer: CTCCTTCCTTTTCGGTTAGAG

Resource Information

• Supplemental Documents:
  • pCfB2197-PrGNP1-mKate2-NATXM.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For further details refer to: EasyClone 2.0 Yeast Toolkit (Addgene Kit #1000000073 )
EasyClone 2.0: expanded toolkit of integrative vectors for stable gene expression in industrial Saccharomyces cerevisiae strains. Stovicek V, Borja GM, Forster J, Borodina I. J Ind Microbiol Biotechnol. 2015 Nov;42(11):1519-31. doi: 10.1007/s10295-015-1684-8. Epub 2015 Sep 16.