Skip to main content
Addgene

p2711-pHAGE2-Ef1aL-TAZ4SA-UBC-tagBFP-loxP
(Plasmid #216480)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216480 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHAGE2
  • Total vector size (bp) 9489
  • Vector type
    Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TAZ4SA
  • Alt name
    TAZ
  • Alt name
    WWTR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1302
  • Mutation
    S66A, S89A, S117A, S311A
  • Entrez Gene
    WWTR1 (a.k.a. TAZ)
  • Promoter EF1aL

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gctagcggccgccATGGACTACAAAGACCATGACGGT
  • 3′ sequencing primer gcgcggatccTCACACCACTTTGTACAAGAAAGTTGGG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tagBFP
  • Species
    Synthetic
  • Promoter UBC

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer aatccatatggccatgagcgagctgattaagg
  • 3′ sequencing primer acgaatccatatggccatgagcgagctgattaagg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2711-pHAGE2-Ef1aL-TAZ4SA-UBC-tagBFP-loxP was a gift from Darrell Kotton (Addgene plasmid # 216480 ; http://n2t.net/addgene:216480 ; RRID:Addgene_216480)

  • For your References section:

    Generation of human alveolar epithelial type I cells from pluripotent stem cells. Burgess CL, Huang J, Bawa PS, Alysandratos KD, Minakin K, Ayers LJ, Morley MP, Babu A, Villacorta-Martin C, Yampolskaya M, Hinds A, Thapa BR, Wang F, Matschulat A, Mehta P, Morrisey EE, Varelas X, Kotton DN. Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017. 10.1016/j.stem.2024.03.017 PubMed 38642558
Related items:
Commonly requested with: