pC1-oROS-HT-CaaX
(Plasmid
#216417)
-
PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the intracellular site of cell membranes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3.1
- Total vector size (bp) 5671
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoROS-HT-CaaX
-
SpeciesE.Coli
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaagacgatcatcgccctgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38352381/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-oROS-HT-CaaX was a gift from Andre Berndt (Addgene plasmid # 216417 ; http://n2t.net/addgene:216417 ; RRID:Addgene_216417) -
For your References section:
Far-red and sensitive sensor for monitoring real time H2O2 dynamics with subcellular resolution and in multi-parametric imaging applications. Lee J.D., Nguyen A., Jin Z.R., Moghadasi A., Gibbs C.E., Wait S.J., Evitts K.M., Asencio A., Bremner S.B., Zuniga S., Chavan V., Williams A., Smith N., Regnier M., Young J.E., Mack D., Nance E., Boyle P.M., Berndt A.. bioRxiv 2024.02.06.579232 10.1101/2024.02.06.579232