AAV2_CAG_oROS-HT(C199S)_WPRE
(Plasmid
#216415)
-
PurposeEncodes the loss-of-function mutation C199S of genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectors
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
- Total vector size (bp) 6351
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameoROS-HT(C199S)
-
SpeciesE.Coli
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaagacgatcatcgccctgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38352381/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV2_CAG_oROS-HT(C199S)_WPRE was a gift from Andre Berndt (Addgene plasmid # 216415 ; http://n2t.net/addgene:216415 ; RRID:Addgene_216415) -
For your References section:
Far-red and sensitive sensor for monitoring real time H2O2 dynamics with subcellular resolution and in multi-parametric imaging applications. Lee J.D., Nguyen A., Jin Z.R., Moghadasi A., Gibbs C.E., Wait S.J., Evitts K.M., Asencio A., Bremner S.B., Zuniga S., Chavan V., Williams A., Smith N., Regnier M., Young J.E., Mack D., Nance E., Boyle P.M., Berndt A.. bioRxiv 2024.02.06.579232 10.1101/2024.02.06.579232