pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA
(Plasmid
#216323)
-
PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV2.1
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSplit Cas9-VPR + splice acceptor site
-
SpeciesSynthetic
-
Insert Size (bp)3743
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AACCCGCCATGCTACTTATCTACGTAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA was a gift from Elvir Becirovic (Addgene plasmid # 216323 ; http://n2t.net/addgene:216323 ; RRID:Addgene_216323) -
For your References section:
mRNA trans-splicing dual AAV vectors for (epi)genome editing and gene therapy. Riedmayr LM, Hinrichsmeyer KS, Thalhammer SB, Mittas DM, Karguth N, Otify DY, Bohm S, Weber VJ, Bartoschek MD, Splith V, Brummer M, Ferreira R, Boon N, Wogenstein GM, Grimm C, Wijnholds J, Mehlfeld V, Michalakis S, Fenske S, Biel M, Becirovic E. Nat Commun. 2023 Oct 18;14(1):6578. doi: 10.1038/s41467-023-42386-0. 10.1038/s41467-023-42386-0 PubMed 37852949