pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA
(Plasmid #216322)

• Purpose: Transactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).
• Depositing Lab: Elvir Becirovic
• Publication: Riedmayr et al Nat Commun. 2023 Oct 18;14(1):6578. doi: 10.1038/s41467-023-42386-0.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV2.1
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Split Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation
• Species: Synthetic
• Insert Size (bp): 2391
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BshTI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: Gggaattcgcccttaactcgagaac

Resource Information

• Supplemental Documents:
  • pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry