Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA
(Plasmid #216321)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216321 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2.1
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Split Luciferase + splice acceptor site
  • Species
    Synthetic
  • Insert Size (bp)
    780
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer Gggaattcgcccttaactcgagaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA was a gift from Elvir Becirovic (Addgene plasmid # 216321 ; http://n2t.net/addgene:216321 ; RRID:Addgene_216321)
  • For your References section:

    mRNA trans-splicing dual AAV vectors for (epi)genome editing and gene therapy. Riedmayr LM, Hinrichsmeyer KS, Thalhammer SB, Mittas DM, Karguth N, Otify DY, Bohm S, Weber VJ, Bartoschek MD, Splith V, Brummer M, Ferreira R, Boon N, Wogenstein GM, Grimm C, Wijnholds J, Mehlfeld V, Michalakis S, Fenske S, Biel M, Becirovic E. Nat Commun. 2023 Oct 18;14(1):6578. doi: 10.1038/s41467-023-42386-0. 10.1038/s41467-023-42386-0 PubMed 37852949