Skip to main content
Addgene

pAAV-hSyn-FAS-GCaMP6f-WPRE
(Plasmid #216277)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216277 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hSyn-insert-WPRE-hGHpA
  • Backbone manufacturer
    Bryan Roth
  • Backbone size w/o insert (bp) 4536
  • Total vector size (bp) 6007
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Insert Size (bp)
    1362
  • Promoter human synapsin 1 (hSyn)
  • Tags / Fusion Proteins
    • 6XHIS (N terminal on insert)
    • Xpress (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer hSyn-Fwd, TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer WPRE-Rev, GCAGCGTATCCACATAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Douglas Kim & GENIE Project (Addgene plasmid 40755); Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen TW, Wardill TJ, Sun Y, Pulver SR, Renninger SL, Baohan A, Schreiter ER, Kerr RA, Orger MB, Jayaraman V, Looger LL, Svoboda K, Kim DS. Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. 10.1038/nature12354 PubMed 23868258

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-FAS-GCaMP6f-WPRE was a gift from Guohong Cui (Addgene plasmid # 216277 ; http://n2t.net/addgene:216277 ; RRID:Addgene_216277)
  • For your References section:

    Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250