pAAV-hSyn-FAS-GCaMP6f-WPRE
(Plasmid
#216277)
-
PurposeAAV vector with hSynapsin promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in neurons that express Cre recombinase)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-hSyn-insert-WPRE-hGHpA
-
Backbone manufacturerBryan Roth
- Backbone size w/o insert (bp) 4536
- Total vector size (bp) 6007
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
Insert Size (bp)1362
- Promoter human synapsin 1 (hSyn)
-
Tags
/ Fusion Proteins
- 6XHIS (N terminal on insert)
- Xpress (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer hSyn-Fwd, TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer WPRE-Rev, GCAGCGTATCCACATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDouglas Kim & GENIE Project (Addgene plasmid 40755); Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen TW, Wardill TJ, Sun Y, Pulver SR, Renninger SL, Baohan A, Schreiter ER, Kerr RA, Orger MB, Jayaraman V, Looger LL, Svoboda K, Kim DS. Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. 10.1038/nature12354 PubMed 23868258
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FAS-GCaMP6f-WPRE was a gift from Guohong Cui (Addgene plasmid # 216277 ; http://n2t.net/addgene:216277 ; RRID:Addgene_216277) -
For your References section:
Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250