pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
(Plasmid #216276)

• Purpose: AAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1a
• Depositing Lab: Guohong Cui
• Publication: Meng et al Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3.

Backbone

• Vector backbone: pAAV-hSyn-DIO-insert-WPRE-hGHpA
• Backbone manufacturer: Bryan Roth
• Backbone size w/o insert (bp): 4805
• Total vector size (bp): 6499
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-jRGECO1a
• Alt name: NES-R-GECO1.0 variant 1670
• Insert Size (bp): 1413
• Promoter: human synapsin 1 (hSyn)
• Tags / Fusion Proteins:
  • 6XHIS (N terminal on insert)
  • Xpress (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: hSyn-Fwd, TCGTGTCGTGCCTGAGAGCG
• 3′ sequencing primer: WPRE-Rev, GCAGCGTATCCACATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Vivek Jayaraman, Ph.D., Douglas S. Kim, Ph.D., Loren L. Looger, Ph.D., Karel Svoboda, Ph.D. from the GENIE Project, Janelia Research Campus, Howard Hughes Medical Institute (Addgene plasmid 61563). Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727. 10.7554/eLife.12727 PubMed 27011354.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry