Skip to main content
Addgene

pAAV-hSyn-DIO-GCaMP6f-WPRE
(Plasmid #216275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216275 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-hSyn-DIO-insert-WPRE-hGHpA
  • Backbone manufacturer
    Bryan Roth
  • Backbone size w/o insert (bp) 4805
  • Total vector size (bp) 6499
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Insert Size (bp)
    1362
  • Promoter human Synapsin 1 (hSyn)
  • Tags / Fusion Proteins
    • 6XHIS (N terminal on insert)
    • Xpress (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer hSyn-Fwd, TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer WPRE-Rev, GCAGCGTATCCACATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vivek Jayaraman, Ph.D., Douglas S. Kim, Ph.D., Loren L. Looger, Ph.D., Karel Svoboda, Ph.D. from the GENIE Project, Janelia Research Campus, Howard Hughes Medical Institute (Addgene plasmid 61563). Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727. 10.7554/eLife.12727 PubMed 27011354.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO-GCaMP6f-WPRE was a gift from Guohong Cui (Addgene plasmid # 216275 ; http://n2t.net/addgene:216275 ; RRID:Addgene_216275)
  • For your References section:

    Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250