pET151-GyrB_A467
(Plasmid
#216234)
-
PurposeS. aureus USA300 GyrB mutant A467 residue codon-optimized for E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET101
-
Backbone manufacturerThermo
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 7689
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA gyrase
-
Alt namegyrB
-
SpeciesS. aureus
-
Insert Size (bp)1932
-
MutationChanged alanine 467 to valine
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET151-GyrB_A467 was a gift from Eric Brown (Addgene plasmid # 216234 ; http://n2t.net/addgene:216234 ; RRID:Addgene_216234) -
For your References section:
A platform for predicting mechanism of action based on bacterial transcriptional responses identifies an unusual DNA gyrase inhibitor. French S, Guo ABY, Ellis MJ, Deisinger JP, Johnson JW, Rachwalski K, Piquette ZA, Lluka T, Zary M, Gamage S, Magolan J, Brown ED. Cell Rep. 2024 Apr 4;43(4):114053. doi: 10.1016/j.celrep.2024.114053. 10.1016/j.celrep.2024.114053 PubMed 38578824