TDP-43 mRuby K84ONBK
(Plasmid
#216226)
-
PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerNovopro
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTransactive response DNA binding protein of 43 kDa
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1968
-
MutationLysine 84 mutated to a TAG stop codon
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
- Promoter CMV Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDP-43 mRuby K84ONBK was a gift from Jennifer Lee (Addgene plasmid # 216226 ; http://n2t.net/addgene:216226 ; RRID:Addgene_216226) -
For your References section:
Genetically encoded lysine photocage for spatiotemporal control of TDP-43 nuclear import. Shadish JA, Lee JC. Biophys Chem. 2024 Jan 23;307:107191. doi: 10.1016/j.bpc.2024.107191. 10.1016/j.bpc.2024.107191 PubMed 38290242