Skip to main content
Addgene

pSfinx-mYFP
(Plasmid #216206)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216206 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSfinx, derived from pGr106
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    monomeric yellow fluorescent protein
  • Alt name
    mYFP
  • Species
    Aequorea victoria

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiIA (not destroyed)
  • 3′ cloning site SfiIB (not destroyed)
  • 5′ sequencing primer GCTTGCAAACTAGATGCAGAAA
  • 3′ sequencing primer CTGTGTTGTGCTAGCTGGTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For transformation into Agrobacterium, Agrobacterium tumefaciens strain, containing the helper plasmid pSOUP (also known as pSaRep or pIC-SArep) should be used.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSfinx-mYFP was a gift from Takaki Maekawa (Addgene plasmid # 216206 ; http://n2t.net/addgene:216206 ; RRID:Addgene_216206)

  • For your References section:

    A disease resistance assay in Nicotiana benthamiana reveals the immune function of Response to HopBA1. Hasegawa K, Timmers T, Chai J, Maekawa T. Plant Physiol. 2024 Jul 8:kiae368. doi: 10.1093/plphys/kiae368. 10.1093/plphys/kiae368 PubMed 38976586
Related items: