pSfinx-mYFP
(Plasmid #216206)

• Purpose: A simplified disease resistance assay using YFP-expressing Potato Virus X in N. benthamiana
• Depositing Lab: Takaki Maekawa
• Publication: Hasegawa et al Plant Physiol. 2024 Jul 8:kiae368. doi: 10.1093/plphys/kiae368.

Backbone

• Vector backbone: pSfinx, derived from pGr106
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: monomeric yellow fluorescent protein
• Alt name: mYFP
• Species: Aequorea victoria

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiIA (not destroyed)
• 3′ cloning site: SfiIB (not destroyed)
• 5′ sequencing primer: GCTTGCAAACTAGATGCAGAAA
• 3′ sequencing primer: CTGTGTTGTGCTAGCTGGTG

Resource Information

• Supplemental Documents:
  • PVXYFP.plasmid_annotations.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For transformation into Agrobacterium, Agrobacterium tumefaciens strain, containing the helper plasmid pSOUP (also known as pSaRep or pIC-SArep) should be used.