Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSPObooster
(Plasmid #216160)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216160 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRG216
  • Backbone size w/o insert (bp) 4557
  • Total vector size (bp) 10098
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MKT1(30G)
  • Alt name
    MKT1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    3649
  • Mutation
    MKT1 gene containing an aspartic acid to glycine mutation at position 30 in the amino sequence
  • Entrez Gene
    MKT1 (a.k.a. YNL085W)
  • Promoter endogenous promoter

Cloning Information for Gene/Insert 1

  • Cloning method Other
  • 5′ sequencing primer aagtaggaagaatgactgag
  • 3′ sequencing primer ctcctatttctaccgtgatt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RME1(ins-308A)
  • Alt name
    RME1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2029
  • Mutation
    RME1 gene with an adenine insertion at position -308 in the RME1 promoter region
  • Entrez Gene
    RME1 (a.k.a. YGR044C, CSP1)
  • Promoter endogenous promoter

Cloning Information for Gene/Insert 2

  • Cloning method Other
  • 5′ sequencing primer ctgtccaaagaagcaaagtg
  • 3′ sequencing primer tcacattatttagtccgtcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPObooster was a gift from Grant Brown (Addgene plasmid # 216160 ; http://n2t.net/addgene:216160 ; RRID:Addgene_216160)