pSPObooster
(Plasmid
#216160)
-
PurposePlasmid expressing the RME1(ins-308A) and MKT1(30G) genes from S. cerevisiae to correct sporulation defect of S288C derived yeast lab strains
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRG216
- Backbone size w/o insert (bp) 4557
- Total vector size (bp) 10098
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMKT1(30G)
-
Alt nameMKT1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3649
-
MutationMKT1 gene containing an aspartic acid to glycine mutation at position 30 in the amino sequence
-
Entrez GeneMKT1 (a.k.a. YNL085W)
- Promoter endogenous promoter
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer aagtaggaagaatgactgag
- 3′ sequencing primer ctcctatttctaccgtgatt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRME1(ins-308A)
-
Alt nameRME1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2029
-
MutationRME1 gene with an adenine insertion at position -308 in the RME1 promoter region
-
Entrez GeneRME1 (a.k.a. YGR044C, CSP1)
- Promoter endogenous promoter
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer ctgtccaaagaagcaaagtg
- 3′ sequencing primer tcacattatttagtccgtcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPObooster was a gift from Grant Brown (Addgene plasmid # 216160 ; http://n2t.net/addgene:216160 ; RRID:Addgene_216160) -
For your References section:
pSPObooster: A Plasmid System to Improve Sporulation Efficiency of Saccharomyces cerevisiae Lab Strains. Loll-Krippleber R, Jiang YK, Brown GW. Yeast. 2024 Sep 9. doi: 10.1002/yea.3978. 10.1002/yea.3978 PubMed 39248173