TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
(Plasmid
#216152)
-
PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11']
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTwist CMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsMUST use stable bacterial line to avoid recombination of UG-rich region (e.g. Stbl3, NEB Stable)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet with cryptic exon and C-terminal FLAG
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTCTTGGTGCCAGCTTATCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.15.565967 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone was a gift from Pietro Fratta (Addgene plasmid # 216152 ; http://n2t.net/addgene:216152 ; RRID:Addgene_216152) -
For your References section:
Creation of de novo cryptic splicing for ALS/FTD precision medicine. Wilkins OG, Chien MZYJ, Wlaschin JJ, Pisliakova M, Thompson D, Digby H, Simkin RL, Diaz JA, Mehta PR, Keuss MJ, Zanovello M, Brown AL, Harley P, Darbey A, Karda R, Fisher EMC, Cunningham TJ, Le Pichon CE, Ule J, Fratta P. bioRxiv. 2023 Nov 15:2023.11.15.565967. doi: 10.1101/2023.11.15.565967. Preprint. 10.1101/2023.11.15.565967 PubMed 38014203
