pC3.1_CAG_oROS-Gr_LF(C199S)
(Plasmid
#216114)
-
PurposeExpresses the loss-of-function version of the genetically encoded, ratiometric hydrogen peroxide sensor oROS-Gr in mamalian cells.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216114 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3.1
- Total vector size (bp) 8045
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoROS-Gr_LF(C199S)
-
SpeciesE.Coli
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaagacgatcatcgccctgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38352381/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC3.1_CAG_oROS-Gr_LF(C199S) was a gift from Andre Berndt (Addgene plasmid # 216114 ; http://n2t.net/addgene:216114 ; RRID:Addgene_216114) -
For your References section:
Structure-guided engineering of a fast genetically encoded sensor for real-time H2O2 monitoring. Lee J.D., Won. W., Kimball K., Wang Y., Yeboah F., Evitts K.M., Neiswanger C., Schattauer S., Rappleye M., Bremner S.B., Chun C., Smith N., Mack D.L., Young J.E., Lee C.J., Chavkin C., Berndt A.. bioRxiv 2024.01.31.578117 10.1101/2024.01.31.578117