Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYHY2
(Plasmid #216108)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216108 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYHY1
  • Total vector size (bp) 7446
  • Vector type
    Bacterial Expression, Synthetic Biology ; E. coli-Bacteroides shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also contains erythromycin for selection in Bacteroides species
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NanoLuc
  • Promoter BfP1E6 promoter
  • Tags / Fusion Proteins
    • 3xFLAG tag (C terminal on insert)
    • BT0294 signal peptide (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagtgcactgcagtggcgat
  • 3′ sequencing primer ggtaactgtcagaccaagtttactc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYHY2 was a gift from Shannon Sirk (Addgene plasmid # 216108 ; http://n2t.net/addgene:216108 ; RRID:Addgene_216108)
  • For your References section:

    A molecular toolkit for heterologous protein secretion across Bacteroides species. Yeh YH, Kelly VW, Pour RR, Sirk SJ. bioRxiv. 2023 Dec 15:2023.12.14.571725. doi: 10.1101/2023.12.14.571725. Preprint. 10.1101/2023.12.14.571725 PubMed 38168418
Commonly requested with: