pYHY2
(Plasmid #216108)

• Purpose: Constitutive expression of secretory BT0294 SP-NanoLuc via BfP1E6-RBS8 promoter-RBS pair in Bacteroides species.
• Depositing Lab: Shannon Sirk
• Publication: Yeh et al bioRxiv. 2023 Dec 15:2023.12.14.571725. doi: 10.1101/2023.12.14.571725. Preprint.

Backbone

• Vector backbone: pYHY1
• Total vector size (bp): 7446
• Vector type: Bacterial Expression, Synthetic Biology ; E. coli-Bacteroides shuttle vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Also contains erythromycin for selection in Bacteroides species
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NanoLuc
• Promoter: BfP1E6 promoter
• Tags / Fusion Proteins:
  • 3xFLAG tag (C terminal on insert)
  • BT0294 signal peptide (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tagtgcactgcagtggcgat
• 3′ sequencing primer: ggtaactgtcagaccaagtttactc

Resource Information

• Supplemental Documents:
  • pyhy2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.12.14.571725v1 for bioRxiv preprint.