Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRDB_162
(Plasmid #216092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216092 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRDA_722
  • Vector type
    Lentiviral, CRISPR ; Positive Controls

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD47 guide
  • gRNA/shRNA sequence
    CAGCAACAGCGCCGCTACCA
  • Species
    Other

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRDB_162 was a gift from John Doench (Addgene plasmid # 216092 ; http://n2t.net/addgene:216092 ; RRID:Addgene_216092)
  • For your References section:

    Modular vector assembly enables rapid assessment of emerging CRISPR technologies. McGee AV, Liu YV, Griffith AL, Szegletes ZM, Wen B, Kraus C, Miller NW, Steger RJ, Escude Velasco B, Bosch JA, Zirin JD, Viswanatha R, Sontheimer EJ, Goodale A, Greene MA, Green TM, Doench JG. Cell Genom. 2024 Mar 13;4(3):100519. doi: 10.1016/j.xgen.2024.100519. 10.1016/j.xgen.2024.100519 PubMed 38484704