pRDA_834
(Plasmid
#216087)
-
PurposeCas9 [Sp] knockout targeting CD59, positive control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRDA_722
-
Vector typeLentiviral, CRISPR ; Positive Controls
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD59 guide
-
gRNA/shRNA sequenceAAAATCAGATGAACAATTGA
-
SpeciesOther
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRDA_834 was a gift from John Doench (Addgene plasmid # 216087 ; http://n2t.net/addgene:216087 ; RRID:Addgene_216087) -
For your References section:
Modular vector assembly enables rapid assessment of emerging CRISPR technologies. McGee AV, Liu YV, Griffith AL, Szegletes ZM, Wen B, Kraus C, Miller NW, Steger RJ, Escude Velasco B, Bosch JA, Zirin JD, Viswanatha R, Sontheimer EJ, Goodale A, Greene MA, Green TM, Doench JG. Cell Genom. 2024 Mar 13;4(3):100519. doi: 10.1016/j.xgen.2024.100519. 10.1016/j.xgen.2024.100519 PubMed 38484704