punc-119cR
(Plasmid #21596)

• Depositing Lab: Al Fisher
• Publication: Ferguson et al Plasmid. 2009 Jun 8. ():.

Backbone

• Vector backbone: R6K origin PCR fragment
• Backbone manufacturer: Epicentre
• Backbone size w/o insert (bp): 300
• Vector type: Worm Expression ; Adds unc-119 marker to Amp resistant plasmids
• Selectable markers: unc-119, mCherry

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir116
• Growth instructions: Requires pir expressing bacterial strain such as EC100 pir-116
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: unc-119:mCherry
• Alt name: kanamycin resistance
• Alt name: mCherry
• Alt name: unc-119
• Species: C. elegans (nematode)
• Insert Size (bp): 3200
• Mutation: N/A
• GenBank ID: NM_066998
• Entrez Gene: unc-119 (a.k.a. CELE_M142.1)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHi (not destroyed)
• 5′ sequencing primer: GCACTTTTCGGGGAAATGTGC
• 3′ sequencing primer: GGTCTGACAGTTACCAATGCTTAATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The R6K replication origin was generated via PCR from pMOD4 (Epicentre). The kanamycin resistance gene was generated via PCR from pKRP11 (The Cloning Vector collection). The unc-119 gene was subcloned from pCG150 (available from Addgene). The mCherry sequence was generated by PCR from pAA64.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has small deletions within the KanR gene. We generated these fragments by PCR so it is definitely possible that these were generated during amplification, these changes must not impair function as the construct is Kan resistant both as a plasmid and following recombination.

The other mismatches in 21596 are in a polylinker between the KanR gene and the unc-119 3’ UTR and should not cause any problems.