pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
(Plasmid #215759)

• Purpose: HDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)
• Depositing Lab: Dimitrios Wagner
• Publication: Kath et al Blood. 2024 Mar 17:blood.2023020973. doi: 10.1182/blood.2023020973.

Backbone

• Vector backbone: pTwist
• Backbone manufacturer: Twist Bioscience
• Backbone size w/o insert (bp): 2221
• Total vector size (bp): 4452
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CD247-truncCD19CAR-GSG
• Species: H. sapiens (human)
• Insert Size (bp): 2231
• Entrez Gene: CD19 (a.k.a. B4, CVID3)
• Entrez Gene: CD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)
• Tag / Fusion Protein:
  • IgG1 CH3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACTTTGCTGCTTACCGCAGC
• 3′ sequencing primer: TGGCCCCGGATTTTCCTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This sequence encodes a CD3-zeta-deficient CD19-CAR (truncCD19-CAR) for Homology-Dependent Repair (HDR)-mediated in-frame integration into the second exon of the gene CD247 (CD3-zeta) of primary human T cells. It contains an additional GSG-linker in front of the P2A-sequence for high CAR expression. This integration approach produces fusion genes comprising the transgenic, exogenously delivered truncated CAR and the endogenous CD3-zeta gene, resulting in the translation of a full-length CD19-CAR protein. The sequence is derived from the CD19-CAR that was previously used for TRAC-integration (addgene ID: 183473, Kath et al, 2022, doi: https://doi.org/10.1016/j.omtm.2022.03.018)

Use indicated primer pair for amplification of HDR-templates:
Forward Primer: atctgctcgccttgtttccac
Reverse Primer: cctctgcctgagtgtaagccc