Skip to main content
Addgene

dCas9-10xSunTag(22aa)
(Plasmid #215745)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215745 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-10xSunTag
  • Promoter chicken beta-actin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pCAG-dCas9-5xPlat2AflD was a gift from Izuho Hatada (Addgene plasmid #82560)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9-10xSunTag(22aa) was a gift from Albert Jeltsch (Addgene plasmid # 215745 ; http://n2t.net/addgene:215745 ; RRID:Addgene_215745)
  • For your References section:

    Modular dual-color BiAD sensors for locus-specific readout of epigenome modifications in single cells. Kohler AR, Hausser J, Harsch A, Bernhardt S, Haussermann L, Brenner LM, Lungu C, Olayioye MA, Bashtrykov P, Jeltsch A. Cell Rep Methods. 2024 Mar 26:100739. doi: 10.1016/j.crmeth.2024.100739. 10.1016/j.crmeth.2024.100739 PubMed 38554702