pPE3-pPuro
(Plasmid #215722)

• Purpose: Cloning vector for Uni-Vector prime editing system
• Depositing Lab: Kou-Juey Wu
• Publication: Huang et al Biotechnol J. 2024 Feb;19(2):e2300353. doi: 10.1002/biot.202300353.

Backbone

• Vector backbone: pPE2-pPuro
• Vector type: Unspecified
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PE2
• Alt name: Cas9(H840A)-M-MLVrt(D200N, T306K, W313F, T330P, L603W)
• Species: Synthetic; Cas9 is from S. pyogenes; M-MLV RT is from the Moloney murine leukemia virus
• Insert Size (bp): 6272
• Promoter: EFS promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • pPE3-pPuro.gb
• A portion of this plasmid was derived from a plasmid made by: The PE2 is subcloned from pCMV-PE2 (addgene plasmid # 132775)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS identifies a D974G substitution in the Cas9 sequence. The depositing lab has confirmed that the plasmid should function as described in the associated publication.