Skip to main content
Addgene

pcDNAintron-CHIKV-Envelope protein
(Plasmid #215700)

Print

Ordering

Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 215700 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHIKV E3-E2-6K-E1
  • Species
    Chikungunya virus strain 181/clone 25
  • Insert Size (bp)
    2963
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-CHIKV-Envelope protein was a gift from Melinda Brindley (Addgene plasmid # 215700 ; http://n2t.net/addgene:215700 ; RRID:Addgene_215700)

  • For your References section:

    Chikungunya virus release is reduced by TIM-1 receptors through binding of envelope phosphatidylserine. Reyes Ballista JM, Hoover AJ, Noble JT, Acciani MD, Miazgowicz KL, Harrison SA, Tabscott GAL, Duncan A, Barnes DN, Jimenez AR, Brindley MA. J Virol. 2024 Jul 15:e0077524. doi: 10.1128/jvi.00775-24. 10.1128/jvi.00775-24 PubMed 39007616
Related items: