Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNAintron-CHIKV-nsp1-c3xFLAG
(Plasmid #215694)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 215694 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHIKV nsp1
  • Species
    Chikungunya virus strain 181/clone 25
  • Insert Size (bp)
    1667
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-CHIKV-nsp1-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215694 ; http://n2t.net/addgene:215694 ; RRID:Addgene_215694)
  • For your References section:

    Chikungunya virus release is reduced by TIM-1 receptors through binding of envelope phosphatidylserine. Reyes Ballista JM, Hoover AJ, Noble JT, Acciani MD, Miazgowicz KL, Harrison SA, Tabscott GAL, Duncan A, Barnes DN, Jimenez AR, Brindley MA. J Virol. 2024 Jul 15:e0077524. doi: 10.1128/jvi.00775-24. 10.1128/jvi.00775-24 PubMed 39007616