pcDNAintron-XKR8-n3xFLAG
(Plasmid
#215693)
-
PurposeProduces the XKR8 lipid scramblase with an n-terminal 3xFLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNAintron
- Backbone size w/o insert (bp) 6205
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXKR8-n3xFLAG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1253
-
Entrez GeneXKR8 (a.k.a. XRG8, hXkr8)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNAintron-XKR8-n3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215693 ; http://n2t.net/addgene:215693 ; RRID:Addgene_215693) -
For your References section:
Ebola Virus Requires Phosphatidylserine Scrambling Activity for Efficient Budding and Optimal Infectivity. Acciani MD, Lay Mendoza MF, Havranek KE, Duncan AM, Iyer H, Linn OL, Brindley MA. J Virol. 2021 Sep 27;95(20):e0116521. doi: 10.1128/JVI.01165-21. Epub 2021 Jul 28. 10.1128/JVI.01165-21 PubMed 34319156