pcDNAintron-LASV-GPC-HA-c3xFLAG
(Plasmid
#215691)
-
PurposeProduces the Lassa virus glycoprotein with a c-terminal HA tag and 3xFLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNAintron
- Backbone size w/o insert (bp) 6205
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLASV GP-HA-FLAG
-
SpeciesLassa virus - Josiah strain
-
Insert Size (bp)1500
- Promoter CMV
-
Tag
/ Fusion Protein
- HA-3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNAintron-LASV-GPC-HA-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215691 ; http://n2t.net/addgene:215691 ; RRID:Addgene_215691) -
For your References section:
Identification of Residues in Lassa Virus Glycoprotein Subunit 2 That Are Critical for Protein Function. Willard KA, Alston JT, Acciani M, Brindley MA. Pathogens. 2018 Dec 26;8(1):1. doi: 10.3390/pathogens8010001. 10.3390/pathogens8010001 PubMed 30587764