Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNAintron-LASV-GPC-HA-c3xFLAG
(Plasmid #215691)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 215691 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LASV GP-HA-FLAG
  • Species
    Lassa virus - Josiah strain
  • Insert Size (bp)
    1500
  • Promoter CMV
  • Tag / Fusion Protein
    • HA-3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-LASV-GPC-HA-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215691 ; http://n2t.net/addgene:215691 ; RRID:Addgene_215691)
  • For your References section:

    Identification of Residues in Lassa Virus Glycoprotein Subunit 2 That Are Critical for Protein Function. Willard KA, Alston JT, Acciani M, Brindley MA. Pathogens. 2018 Dec 26;8(1):1. doi: 10.3390/pathogens8010001. 10.3390/pathogens8010001 PubMed 30587764