pcDNAintron-LASV-GPC-c3xFLAG
(Plasmid
#215689)
-
PurposeProduces the Lassa virus glycoprotein with a c-terminal 3xFLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNAintron
- Backbone size w/o insert (bp) 6205
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLASV GP-FLAG
-
SpeciesLassa virus - Josiah strain
-
Insert Size (bp)1541
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNAintron-LASV-GPC-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215689 ; http://n2t.net/addgene:215689 ; RRID:Addgene_215689) -
For your References section:
Mutational Analysis of Lassa Virus Glycoprotein Highlights Regions Required for Alpha-Dystroglycan Utilization. Acciani M, Alston JT, Zhao G, Reynolds H, Ali AM, Xu B, Brindley MA. J Virol. 2017 Aug 24;91(18):e00574-17. doi: 10.1128/JVI.00574-17. Print 2017 Sep 15. 10.1128/JVI.00574-17 PubMed 28679759