pMS18
(Plasmid
#215675)
-
PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing pad
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215675 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDD162
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
-
Alt nameeft-3p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
-
gRNA/shRNA sequenceGAAATCGCCGACTTGCGAGG
-
SpeciesC. elegans (nematode)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS18 was a gift from Patrick Phillips (Addgene plasmid # 215675 ; http://n2t.net/addgene:215675 ; RRID:Addgene_215675) -
For your References section:
Expansion of the split hygromycin toolkit for transgene insertion in Caenorhabditis elegans. Moerdyk-Schauwecker MJ, Jahahn EK, Munoz ZI, Robinson KJ, Phillips PC. MicroPubl Biol. 2024 Jan 29;2024:10.17912/micropub.biology.001091. doi: 10.17912/micropub.biology.001091. eCollection 2024. 10.17912/micropub.biology.001091 PubMed 38351905