pEB018
(Plasmid #215568)

• Purpose: Fuses insert of interest to an HA-tag, stop codon and S. commune Hom2 terminator, with flanks directing the construct to S. commune targeted integration locus
• Depositing Lab: Robin Ohm
• Publication: Targeted gene knock-in plasmid for Schizophyllum commune, including HA-tag (unpublished)

Backbone

• Vector backbone: pPV033
• Backbone manufacturer: Dr. Peter Jan Vonk
• Backbone size w/o insert (bp): 7568
• Total vector size (bp): 8362
• Vector type: Fungal homologous recombination plasmid
• Selectable markers: Nourseothricin, Phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 x Hemagglutinin (HA) Tag / Stop codon / Intron / Hom2-terminator
• Species: Synthetic; Schizophyllum commune
• Insert Size (bp): 794
• GenBank ID: XM_003029710

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: CAGAAAAAACATGTGAGGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use BcuI (SpeI) site to integrate your construct of interest (e.g. promoter + gene) upstream of the HA-tag for integration of the construct at the targeted integration locus in S. commune. Use this approach to complement a gene knockout, combined with the possibility to subsequently perform pull-down experiments like Western Blotting or ChIP-Seq.