pTOCK1
(Plasmid
#215566)
-
PurposeEscherichia coli–Aspergillus spp. shuttle cosmid-based library system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneSuperCos 1
-
Backbone manufacturerAgilent technologies
- Backbone size w/o insert (bp) 7937
- Total vector size (bp) 14937
-
Vector typeEscherichia coli-Aspergillus spp. shuttle cosmid vector
-
Selectable markersAopyrG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAopyrG
-
SpeciesAspergillus oryzae
-
Insert Size (bp)1763
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer GTCTCATGAGCGGATACATA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAMA1
-
SpeciesAspergillus nidulans
-
Insert Size (bp)5251
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TATTTATGCAGAGGCCGAGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameampicillin resistance (bla) ORF
-
Insert Size (bp)861
Cloning Information for Gene/Insert 3
- Cloning method Other
- 5′ sequencing primer AAAGTCTGGAAACGCGGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTOCK1 was a gift from Takuji Oka (Addgene plasmid # 215566 ; http://n2t.net/addgene:215566 ; RRID:Addgene_215566) -
For your References section:
Construction of a Cosmid-Based Ultraefficient Genomic Library System for Filamentous Fungi of the Genus Aspergillus. Kadooka C, Oka T. J Fungi (Basel). 2024 Feb 29;10(3):188. doi: 10.3390/jof10030188. 10.3390/jof10030188 PubMed 38535197