Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTOCK1
(Plasmid #215566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215566 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    SuperCos 1
  • Backbone manufacturer
    Agilent technologies
  • Backbone size w/o insert (bp) 7937
  • Total vector size (bp) 14937
  • Vector type
    Escherichia coli-Aspergillus spp. shuttle cosmid vector
  • Selectable markers
    AopyrG

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AopyrG
  • Species
    Aspergillus oryzae
  • Insert Size (bp)
    1763

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    AMA1
  • Species
    Aspergillus nidulans
  • Insert Size (bp)
    5251

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TATTTATGCAGAGGCCGAGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ampicillin resistance (bla) ORF
  • Insert Size (bp)
    861

Cloning Information for Gene/Insert 3

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTOCK1 was a gift from Takuji Oka (Addgene plasmid # 215566 ; http://n2t.net/addgene:215566 ; RRID:Addgene_215566)
  • For your References section:

    Construction of a Cosmid-Based Ultraefficient Genomic Library System for Filamentous Fungi of the Genus Aspergillus. Kadooka C, Oka T. J Fungi (Basel). 2024 Feb 29;10(3):188. doi: 10.3390/jof10030188. 10.3390/jof10030188 PubMed 38535197