pLigify_Isoeugenol
(Plasmid #215563)

• Purpose: Expresses GFP in response to Isoeugenol
• Depositing Labs: Simon d'Oelsnitz, David Ross
• Publication: d'Oelsnitz et al ACS Synth Biol. 2024 Aug 16;13(8):2577-2586. doi: 10.1021/acssynbio.4c00372. Epub 2024 Jul 19.

Backbone

• Vector backbone: pTwist Kan Medium Copy
• Backbone manufacturer: Twist Biosciences
• Backbone size w/o insert (bp): 2203
• Total vector size (bp): 4505
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: GFP mut2
• Species: Synthetic
• Insert Size (bp): 717
• GenBank ID: WP_008832113.1 ACS28253.1
• Promoter: Piemr

Cloning Information for Gene/Insert 1

• Cloning method: Gene Synthesis
• 5′ sequencing primer: taggactgagctagcGGTAAAcgatac

Gene/Insert 2

• Gene/Insert name: iemR
• Species: Pseudomonas nitroreducens
• Insert Size (bp): 951
• GenBank ID: ACP17972.1
• Promoter: P250

Cloning Information for Gene/Insert 2

• Cloning method: Gene Synthesis
• 5′ sequencing primer: CGAGGCTGGCCTATTGTTGAGGATTTC

Resource Information

• Supplemental Documents:
  • pligify_isoeugenol.gb
• A portion of this plasmid was derived from a plasmid made by: This plasmid was constructed by Twist Biosciences

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry