pLigify_Isoeugenol
(Plasmid
#215563)
-
PurposeExpresses GFP in response to Isoeugenol
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTwist Kan Medium Copy
-
Backbone manufacturerTwist Biosciences
- Backbone size w/o insert (bp) 2203
- Total vector size (bp) 4505
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGFP mut2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDWP_008832113.1 ACS28253.1
- Promoter Piemr
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer taggactgagctagcGGTAAAcgatac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameiemR
-
SpeciesPseudomonas nitroreducens
-
Insert Size (bp)951
-
GenBank IDACP17972.1
- Promoter P250
Cloning Information for Gene/Insert 2
- Cloning method Gene Synthesis
- 5′ sequencing primer CGAGGCTGGCCTATTGTTGAGGATTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was constructed by Twist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLigify_Isoeugenol was a gift from Simon d'Oelsnitz & David Ross (Addgene plasmid # 215563 ; http://n2t.net/addgene:215563 ; RRID:Addgene_215563) -
For your References section:
Ligify: Automated Genome Mining for Ligand-Inducible Transcription Factors. d'Oelsnitz S, Love JD, Ellington AD, Ross D. ACS Synth Biol. 2024 Aug 16;13(8):2577-2586. doi: 10.1021/acssynbio.4c00372. Epub 2024 Jul 19. 10.1021/acssynbio.4c00372 PubMed 39029917