pDsRed2-Keap1
(Plasmid #21551)

• Depositing Lab: Yue Xiong
• Publication: Furukawa et al Mol Cell Biol. 2005 Jan . 25(1):162-71.

Backbone

• Vector backbone: pDsRed2-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3300
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: kelch-like ECH-associated protein 1
• Alt name: KEAP1
• Alt name: INrf2
• Species: H. sapiens (human)
• Insert Size (bp): 1879
• GenBank ID: Q14145
• Entrez Gene: KEAP1 (a.k.a. INrf2, KLHL19)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: 5'd[GTACTGGAACTGGGGGGACAG]
• 3′ sequencing primer: n/a

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry