131-2a_LC
(Plasmid
#215331)
-
PurposeExpression monoclonal antibody 131-2a LC
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 5038
- Total vector size (bp) 5752
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name131-2a_LC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)714
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
- 3′ sequencing primer CTGTAATTGACAGCCTTGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
131-2a_LC was a gift from Joost Snijder (Addgene plasmid # 215331 ; http://n2t.net/addgene:215331 ; RRID:Addgene_215331)