Skip to main content
Addgene

pX552-hSyn-DIO-GCaMP8f_Grin1 gRNA
(Plasmid #215281)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215281 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX552
  • Total vector size (bp) 5971
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Grin1 gRNA
  • Species
    Synthetic
  • Mutation
    See Depositor Comments Below
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • 3′ sequencing primer GATGCTTGGATCAAAATAGGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

During validation, the authors noticed a 1bp deletion of a 'G' at position 254 in the Grin1 guide RNA region of this construct. The sequence of the Grin1 gRNA was thus changed from 5'-GCACGAGCAGATGTTCCGCG-3' to 5'-GCACAGCAGATGTTCCGCG-3'. This does not affect the authors' interpretation of the results, as functional knock-down was observed in both electrophysiology and fiber photometry experiments.

Please visit https://doi.org/10.1101/2023.10.10.561249 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX552-hSyn-DIO-GCaMP8f_Grin1 gRNA was a gift from Bryan Copits (Addgene plasmid # 215281 ; http://n2t.net/addgene:215281 ; RRID:Addgene_215281)
  • For your References section:

    Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa JC, Bland IN, Tooley JR, Kalyanaraman V, Heitmeier M, Creed MC, Copits BA. eNeuro. 2024 Jul 5;11(7):ENEURO.0438-23.2024. doi: 10.1523/ENEURO.0438-23.2024. Print 2024 Jul. 10.1523/ENEURO.0438-23.2024 PubMed 38871457