pX552-EF1a-DIO-mCherry_DicerTTT gRNA
(Plasmid
#215280)
-
PurposeExpresses Dicer Control gRNA in a Cre dependent mcherry vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX552
- Total vector size (bp) 6096
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDicer control gRNA
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
- 3′ sequencing primer GATGCTTGGATCAAAATAGGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.10.10.561249 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX552-EF1a-DIO-mCherry_DicerTTT gRNA was a gift from Bryan Copits (Addgene plasmid # 215280 ; http://n2t.net/addgene:215280 ; RRID:Addgene_215280) -
For your References section:
Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa J.C., Bland I.N., Tooley, J.R., Kalyanaraman V., Heitmeier M., Creed M.C., & Copits B.A.. ENEURO.0438-23.2024 10.1523/ENEURO.0438-23.2024
Map uploaded by the depositor.
