pX552 EF1a DIO Chronos GFP_VgatTTT gRNA
(Plasmid
#215278)
-
PurposeExpresses Vgat Control gRNA in a Cre dependent Chronos GFP vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX552
- Total vector size (bp) 7143
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVgat control gRNA
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
- 3′ sequencing primer GATGCTTGGATCAAAATAGGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.10.10.561249 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX552 EF1a DIO Chronos GFP_VgatTTT gRNA was a gift from Bryan Copits (Addgene plasmid # 215278 ; http://n2t.net/addgene:215278 ; RRID:Addgene_215278) -
For your References section:
Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa JC, Bland IN, Tooley JR, Kalyanaraman V, Heitmeier M, Creed MC, Copits BA. eNeuro. 2024 Jul 5;11(7):ENEURO.0438-23.2024. doi: 10.1523/ENEURO.0438-23.2024. Print 2024 Jul. 10.1523/ENEURO.0438-23.2024 PubMed 38871457