shRNA_SMAD2_1
(Plasmid
#215204)
-
PurposeSupression of shSMAD2_1 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMAD2 shRNA 1
-
gRNA/shRNA sequenceGAACAAACCAGGTCTCTTGAT
-
SpeciesH. sapiens (human)
-
Entrez GeneSMAD2 (a.k.a. CHTD8, JV18, JV18-1, LDS6, MADH2, MADR2, hMAD-2, hSMAD2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shRNA_SMAD2_1 was a gift from Sefi Rosenbluh (Addgene plasmid # 215204 ; http://n2t.net/addgene:215204 ; RRID:Addgene_215204) -
For your References section:
Systematic loss-of-function screens identify pathway-specific functional circular RNAs. Liu L, Neve M, Perlaza-Jimenez L, Xi X, Purcell J, Hawdon A, Conn SJ, Zenker J, Tamayo P, Goodall GJ, Rosenbluh J. Nat Cell Biol. 2024 Aug;26(8):1359-1372. doi: 10.1038/s41556-024-01467-y. Epub 2024 Aug 2. 10.1038/s41556-024-01467-y PubMed 39095657