pMamCol1
(Plasmid #215184)

• Purpose: Allows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coli
• Depositing Lab: Krishna Kishore Inampudi
• Publication: Mammalian and bacterial dual expression vector for Recombinant Protein production from mammalian and Bacterial Cells (unpublished)

Backbone

• Vector backbone: pUC57-mini-Kana-BsmBI free-terminator-T7 deleted
• Backbone manufacturer: GeneScript
• Backbone size w/o insert (bp): 2200
• Total vector size (bp): 14603
• Vector type: Mammalian Expression, Bacterial Expression, AAV, CRISPR, Synthetic Biology ; Recombinant Protein Expression
• Selectable markers: Hygromycin ; AausFP1 fluorescent protein for stable cell selection via FACS.

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: NEB advises growing the plasmid at 30 degrees Celsius for even higher transgene stability. This in our hands, has also resulted in higher plasmid yields. Can add 1 mM IPTG during clone selection to do Purple-White Screening of positive clones.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tsPurple
• Alt name: Tinsel Purple Chromoprotein
• Species: Synthetic; Actinia equina
• Insert Size (bp): 687
• Promoter: TetON 3G Bidirectional for Mammalian and Trc with Lac operator inbuilt for E. coli
• Tag / Fusion Protein:
  • SNAC-StrepII tag (C terminal on backbone)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: caccatggcgcaggtgt
• 3′ sequencing primer: tgtgtgtcggctcaccttcgg

Resource Information

• Supplemental Documents:
  • pMamcol1.gb
• A portion of this plasmid was derived from a plasmid made by: Gene Synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Hygromycin cassette has been synthesized such that it works in Bacteria as well.