GST-TNR(aa1-204)
(Plasmid
#21514)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCG-GST
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTNRC6A
-
Alt nameGW182
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
Mutationcontain aa1-204
-
GenBank IDNM_014494
-
Entrez GeneTNRC6A (a.k.a. CAGH26, FAME6, GW1, GW182, TNRC6)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bam HI (destroyed during cloning)
- 3′ cloning site Bam HI (destroyed during cloning)
- 5′ sequencing primer CAGCAAGTATATAGCATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-TNR(aa1-204) was a gift from Edward Chan (Addgene plasmid # 21514 ; http://n2t.net/addgene:21514 ; RRID:Addgene_21514) -
For your References section:
The C-terminal half of human Ago2 binds to multiple GW-rich regions of GW182 and requires GW182 to mediate silencing. Lian SL, Li S, Abadal GX, Pauley BA, Fritzler MJ, Chan EK. RNA. 2009 May . 15(5):804-13. 10.1261/rna.1229409 PubMed 19324964