B2329_mCherry-FKBP2x
(Plasmid
#215103)
-
PurposeExpresses mCherry-FKBP-FKBP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemCherryN1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-FKBP-FKBP
-
Insert Size (bp)1557
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B2329_mCherry-FKBP2x was a gift from Chandra Tucker (Addgene plasmid # 215103 ; http://n2t.net/addgene:215103 ; RRID:Addgene_215103) -
For your References section:
A platform to induce and mature biomolecular condensates using chemicals and light. Hernandez-Candia CN, Brady BR, Harrison E, Tucker CL. Nat Chem Biol. 2024 Jan 8. doi: 10.1038/s41589-023-01520-1. 10.1038/s41589-023-01520-1 PubMed 38191942