B2342_BTB-mCherry
(Plasmid #215095)

• Purpose: Expresses BCL6 BTB(1-129)-mCherry in mammalian cells
• Depositing Lab: Chandra Tucker
• Publication: Hernandez-Candia et al Nat Chem Biol. 2024 Jan 8. doi: 10.1038/s41589-023-01520-1.

Backbone

• Vector backbone: mCherryN1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCL6 BTB
• Species: H. sapiens (human)
• Insert Size (bp): 1170
• GenBank ID: NM_001706.5
• Entrez Gene: BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Daniel Hodson (BTB from Addgene plasmid # 135305)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry