pcDNA3.1_V5-TWIST1_HAND2ins
(Plasmid
#215038)
-
PurposeMammalian expression of human TWIST1 (with insertion from HAND2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5366
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametwist family bHLH transcription factor 1
-
Alt nameTWIST1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)654
-
MutationTWIST1 bHLH loop with insertion from HAND2 bHLH loop (D141K142insT)
-
Entrez GeneTWIST1 (a.k.a. ACS3, BPES2, BPES3, CRS, CRS1, CSO, SCS, SWCOS, TWIST, bHLHa38)
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACGACTCACTATAGGGAGACCC
- 3′ sequencing primer GAGGGGCAAACAACAGATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_V5-TWIST1_HAND2ins was a gift from Joanna Wysocka (Addgene plasmid # 215038 ; http://n2t.net/addgene:215038 ; RRID:Addgene_215038) -
For your References section:
DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408