Addgene: pcDNA3.1_V5-TWIST1_NEUROD1ins Skip to main content
Addgene

pcDNA3.1_V5-TWIST1_NEUROD1ins
(Plasmid #215036)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215036 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5366
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    twist family bHLH transcription factor 1
  • Alt name
    TWIST1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    654
  • Mutation
    TWIST1 bHLH loop with insertion from NEUROD1 bHLH loop (P139S140insK)
  • Entrez Gene
    TWIST1 (a.k.a. ACS3, BPES2, BPES3, CRS, CRS1, CSO, SCS, SWCOS, TWIST, bHLHa38)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACGACTCACTATAGGGAGACCC
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_V5-TWIST1_NEUROD1ins was a gift from Joanna Wysocka (Addgene plasmid # 215036 ; http://n2t.net/addgene:215036 ; RRID:Addgene_215036)
  • For your References section:

    DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408