Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1_V5-TWIST1_TAL1loop
(Plasmid #215035)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5366
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    twist family bHLH transcription factor 1
  • Alt name
    TWIST1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    654
  • Mutation
    TWIST1 bHLH loop (aa137-141, TLPSD) replaced with TAL1 bHLH loop (aaX-X, THPPDK)
  • Entrez Gene
    TWIST1 (a.k.a. ACS3, BPES2, BPES3, CRS, CRS1, CSO, SCS, SWCOS, TWIST, bHLHa38)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACGACTCACTATAGGGAGACCC
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_V5-TWIST1_TAL1loop was a gift from Joanna Wysocka (Addgene plasmid # 215035 ; http://n2t.net/addgene:215035 ; RRID:Addgene_215035)
  • For your References section:

    DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408