Skip to main content
Addgene

pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant
(Plasmid #215026)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215026 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Promoter, GenBank: U47298.2
  • Backbone size w/o insert (bp) 5016
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Minimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutated
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    488
  • Mutation
    4X E-box mutations within Coordinator motifs
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
  • 3′ sequencing primer GAGTTAGGGGCGGGATGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant was a gift from Joanna Wysocka (Addgene plasmid # 215026 ; http://n2t.net/addgene:215026 ; RRID:Addgene_215026)

  • For your References section:

    DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408
Related items: